Orthologous regulated operons containing malK gene
| Regulog: | MdxR - Listeriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltodextrin utilization; Maltose utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Listeria innocua Clip11262 | ||||
|
Position: -172
Score: 5.85679 Sequence: TGTTGTTATCGGTAACATGT
Locus tag: lin2230
Name: mdxE Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
Locus tag: lin2229
Name: mdxF Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lin2228
Name: mdxG Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lin2227
Name: malA Funciton: Putative maltodextrin utilization protein
Locus tag: lin2226
Name: malK Funciton: Maltose phosphorylase (EC 2.4.1.8) |
||||
| mdxE-mdxF-mdxG-malA-malK | -172 | 5.9 | TGTTGTTATCGGTAACATGT | lin2230 |
| Listeria monocytogenes EGD-e | ||||
|
Position: -171
Score: 5.85679 Sequence: TGTTGTTATCGGTAACATGT
Locus tag: lmo2125
Name: mdxE Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
Locus tag: lmo2124
Name: mdxF Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lmo2123
Name: mdxG Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lmo2122
Name: malA Funciton: Putative maltodextrin utilization protein
Locus tag: lmo2121
Name: malK Funciton: Maltose phosphorylase (EC 2.4.1.8) |
||||
| mdxE-mdxF-mdxG-malA-malK | -171 | 5.9 | TGTTGTTATCGGTAACATGT | lmo2125 |
| Listeria seeligeri serovar 1/2b str. SLCC3954 | ||||
|
Position: -171
Score: 5.85679 Sequence: TGTTGTTATCGGTAACATGT
Locus tag: lse_2114
Name: mdxE Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
Locus tag: lse_2113
Name: mdxF Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lse_2112
Name: mdxG Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lse_2111
Name: malA Funciton: Putative maltodextrin utilization protein
Locus tag: lse_2110
Name: malK Funciton: Maltose phosphorylase (EC 2.4.1.8) |
||||
| mdxE-mdxF-mdxG-malA-malK | -171 | 5.9 | TGTTGTTATCGGTAACATGT | lse_2114 |
| Listeria welshimeri serovar 6b str. SLCC5334 | ||||
|
Position: -170
Score: 5.85679 Sequence: TGTTGTTATCGGTAACATGT
Locus tag: lwe2145
Name: mdxE Funciton: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
Locus tag: lwe2144
Name: mdxF Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lwe2143
Name: mdxG Funciton: Maltose/Maltodextrin ABC transporter, permease protein
Locus tag: lwe2142
Name: malA Funciton: Putative maltodextrin utilization protein
Locus tag: lwe2141
Name: malK Funciton: Maltose phosphorylase (EC 2.4.1.8) |
||||
| mdxE-mdxF-mdxG-malA-malK | -170 | 5.9 | TGTTGTTATCGGTAACATGT | lwe2145 |