Orthologous regulated operons containing cueR2 gene
| Regulog: | CueR - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Ralstonia pickettii 12J | ||||
|
Position: -125
Score: 4.89448 Sequence: ACCTTCCCACGTGGGCAGGCT
Locus tag: Rpic_1805
Name: cueR2 Funciton: Copper-responsive transcriptional regulator, MerR family
Locus tag: Rpic_1804
Name: copA2 Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) |
||||
| cueR2-copA2 | -125 | 4.9 | ACCTTCCCACGTGGGCAGGCT | Rpic_1805 |