Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing galM gene

Properties
Regulog: GalR - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/delta
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -51
Score: 6.14657
Sequence: AACTGCAAACGTTTGCAGCA
Locus tag: Dde_3654
Name: galR
Funciton: Galactose utilization transcriptional regulator GalR, LacI family
Locus tag: Dde_3655
Name: galM
Funciton: Aldose 1-epimerase EC=5.1.3.3
Locus tag: Dde_3656
Name: galA
Funciton: Predicted galactose-specific ABC transporter, ATP-binding component
Locus tag: Dde_3657
Name: galB
Funciton: Predicted galactose-specific ABC transporter, periplasmic component
Locus tag: Dde_3658
Name: galC
Funciton: Predicted galactose-specific ABC transporter, permease components
Locus tag: Dde_3659
Name: galD
Funciton: Predicted galactose-specific ABC transporter, permease protein
galR-galM-galA-galB-galC-galD -51 6.1 AACTGCAAACGTTTGCAGCA Dde_3654
Desulfovibrio salexigens DSM 2638
Position: -101
Score: 5.1603
Sequence: AATGGAAAAGGTTTTCGGTA
Locus tag: Desal_0506
Name: galR
Funciton: Galactose utilization transcriptional regulator GalR, LacI family
Locus tag: Desal_0505
Name: galM
Funciton: Aldose 1-epimerase EC=5.1.3.3
Locus tag: Desal_0504
Name: galA
Funciton: Predicted galactose-specific ABC transporter, ATP-binding component
Locus tag: Desal_0503
Name: galB
Funciton: Predicted galactose-specific ABC transporter, periplasmic component
Locus tag: Desal_0502
Name: galC
Funciton: Predicted galactose-specific ABC transporter, permease components
Locus tag: Desal_0501
Name: galD
Funciton: Predicted galactose-specific ABC transporter, permease protein
galR-galM-galA-galB-galC-galD -101 5.2 AATGGAAAAGGTTTTCGGTA Desal_0506