Orthologous regulated operons containing galM gene
| Regulog: | GalR - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactose utilization |
| Effector: | Galactose |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfovibrio desulfuricans G20 | ||||
|
Position: -51
Score: 6.14657 Sequence: AACTGCAAACGTTTGCAGCA
Locus tag: Dde_3654
Name: galR Funciton: Galactose utilization transcriptional regulator GalR, LacI family
Locus tag: Dde_3655
Name: galM Funciton: Aldose 1-epimerase EC=5.1.3.3
Locus tag: Dde_3656
Name: galA Funciton: Predicted galactose-specific ABC transporter, ATP-binding component
Locus tag: Dde_3657
Name: galB Funciton: Predicted galactose-specific ABC transporter, periplasmic component
Locus tag: Dde_3658
Name: galC Funciton: Predicted galactose-specific ABC transporter, permease components
Locus tag: Dde_3659
Name: galD Funciton: Predicted galactose-specific ABC transporter, permease protein |
||||
| galR-galM-galA-galB-galC-galD | -51 | 6.1 | AACTGCAAACGTTTGCAGCA | Dde_3654 |
| Desulfovibrio salexigens DSM 2638 | ||||
|
Position: -101
Score: 5.1603 Sequence: AATGGAAAAGGTTTTCGGTA
Locus tag: Desal_0506
Name: galR Funciton: Galactose utilization transcriptional regulator GalR, LacI family
Locus tag: Desal_0505
Name: galM Funciton: Aldose 1-epimerase EC=5.1.3.3
Locus tag: Desal_0504
Name: galA Funciton: Predicted galactose-specific ABC transporter, ATP-binding component
Locus tag: Desal_0503
Name: galB Funciton: Predicted galactose-specific ABC transporter, periplasmic component
Locus tag: Desal_0502
Name: galC Funciton: Predicted galactose-specific ABC transporter, permease components
Locus tag: Desal_0501
Name: galD Funciton: Predicted galactose-specific ABC transporter, permease protein |
||||
| galR-galM-galA-galB-galC-galD | -101 | 5.2 | AATGGAAAAGGTTTTCGGTA | Desal_0506 |