Orthologous regulated operons containing galR gene

Properties
Regulog:	GalR - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactose utilization
Effector:	Galactose
Phylum:	Proteobacteria/delta

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -51 Score: 6.14657 Sequence: AACTGCAAACGTTTGCAGCA Locus tag: Dde_3654 Name: galR Funciton: Galactose utilization transcriptional regulator GalR, LacI family Locus tag: Dde_3655 Name: galM Funciton: Aldose 1-epimerase EC=5.1.3.3 Locus tag: Dde_3656 Name: galA Funciton: Predicted galactose-specific ABC transporter, ATP-binding component Locus tag: Dde_3657 Name: galB Funciton: Predicted galactose-specific ABC transporter, periplasmic component Locus tag: Dde_3658 Name: galC Funciton: Predicted galactose-specific ABC transporter, permease components Locus tag: Dde_3659 Name: galD Funciton: Predicted galactose-specific ABC transporter, permease protein
galR-galM-galA-galB-galC-galD	-51	6.1	AACTGCAAACGTTTGCAGCA	Dde_3654
Desulfovibrio salexigens DSM 2638
Position: -101 Score: 5.1603 Sequence: AATGGAAAAGGTTTTCGGTA Locus tag: Desal_0506 Name: galR Funciton: Galactose utilization transcriptional regulator GalR, LacI family Locus tag: Desal_0505 Name: galM Funciton: Aldose 1-epimerase EC=5.1.3.3 Locus tag: Desal_0504 Name: galA Funciton: Predicted galactose-specific ABC transporter, ATP-binding component Locus tag: Desal_0503 Name: galB Funciton: Predicted galactose-specific ABC transporter, periplasmic component Locus tag: Desal_0502 Name: galC Funciton: Predicted galactose-specific ABC transporter, permease components Locus tag: Desal_0501 Name: galD Funciton: Predicted galactose-specific ABC transporter, permease protein
galR-galM-galA-galB-galC-galD	-101	5.2	AATGGAAAAGGTTTTCGGTA	Desal_0506