Orthologous regulated operons containing cueR gene
| Regulog: | CueR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Cellvibrio japonicus Ueda107 | ||||
|
Position: -247
Score: 5.32291 Sequence: ACCTTACCATGATGTCAAGGA
Locus tag: CJA_2024
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: CJA_2025
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR | -247 | 5.3 | ACCTTACCATGATGTCAAGGA | CJA_2024 |
| Saccharophagus degradans 2-40 | ||||
|
Position: -59
Score: 5.55434 Sequence: ACCTTCCTATAATGGGAGGGT
Locus tag: Sde_1950
Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR | -59 | 5.6 | ACCTTCCTATAATGGGAGGGT | Sde_1950 |