Orthologous regulated operons containing celA2 gene
| Regulog: | CelR2 - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Serratia proteamaculans 568 | ||||
|
Position: -96
Score: 7.74597 Sequence: AAATGAGAGCGCTCTCATTT
Locus tag: Spro_4590
Name: celA2 Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
Locus tag: Spro_4591
Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: Spro_4592
Name: celR2 Funciton: Transcriptional regulator for cellobiose utilization, LacI family |
||||
| celA2-bglA-celR2 | -96 | 7.7 | AAATGAGAGCGCTCTCATTT | Spro_4590 |