Orthologous regulated operons containing COG1082 gene
| Regulog: | Sde_0506 - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alteromonas macleodii 'Deep ecotype' | ||||
|
Position: -89
Score: 6.86953 Sequence: AAATGTAACGGGTTACATTT
Locus tag: MADE_00430
Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
Locus tag: MADE_00431
Name: COG1082 Funciton: Predicted sugar isomerase |
||||
| COG0673-COG1082 | -89 | 6.9 | AAATGTAACGGGTTACATTT | MADE_00430 |
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -243
Score: 6.43388 Sequence: AAATGTAACCGTTAGCATTT
Position: -82
Score: 6.73842 Sequence: AAATGAAACCCGTTACATTT
Locus tag: Patl_2690
Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
Locus tag: Patl_2689
Name: COG1082 Funciton: Predicted sugar isomerase |
||||
| COG0673-COG1082 | -243 | 6.4 | AAATGTAACCGTTAGCATTT | Patl_2690 |
| -82 | 6.7 | AAATGAAACCCGTTACATTT | ||