Orthologous regulated operons containing rbsA gene
| Regulog: | RbsR - Thermoanaerobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Thermoanaerobacter ethanolicus X514 | ||||
|
Position: -53
Score: 6.39561 Sequence: ATAGTTAAGCGTTTTACTAA
Position: -40
Score: 5.99899 Sequence: TTACTAAAACGTTAAACCAA
Locus tag: Teth514_0161
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI famil
Locus tag: Teth514_0162
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: Teth514_0163
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: Teth514_0164
Name: rbsA Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
Locus tag: Teth514_0165
Name: rbsC Funciton: Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1)
Locus tag: Teth514_0166
Name: rbsB Funciton: Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1) |
||||
| rbsR-rbsK-rbsD-rbsA-rbsC-rbsB | -53 | 6.4 | ATAGTTAAGCGTTTTACTAA | Teth514_0161 |
| -40 | 6 | TTACTAAAACGTTAAACCAA | ||
| Thermoanaerobacter tengcongensis MB4 | ||||
|
Position: -53
Score: 6.39561 Sequence: ATAGTTAAGCGTTTTACTAA
Position: -40
Score: 6.21713 Sequence: TTACTAAAACGTTAAACTAT
Locus tag: TTE0201
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI famil
Locus tag: TTE0202
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: TTE0203
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: TTE0204
Name: rbsA Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
Locus tag: TTE0205
Name: rbsC Funciton: Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1)
Locus tag: TTE0206
Name: rbsB Funciton: Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1) |
||||
| rbsR-rbsK-rbsD-rbsA-rbsC-rbsB | -53 | 6.4 | ATAGTTAAGCGTTTTACTAA | TTE0201 |
| -40 | 6.2 | TTACTAAAACGTTAAACTAT | ||