Orthologous regulated operons containing Bamb_3698 gene
| Regulog: | ScrR - Burkholderia |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Burkholderia phymatum STM815 | ||||
|
Position: -73
Score: 5.75305 Sequence: CTTCAAAACCGGTTTGGCCT
Position: -51
Score: 5.98118 Sequence: GATCCAAACCGATTTGGAAA
Locus tag: Bphy_6047
Name: sacB Funciton: Levansucrase (EC 2.4.1.10)
Locus tag: Bphy_6048
Name: Bamb_3698 Funciton: Putative transcriptional regulator, GntR family
Locus tag: Bphy_6049
Name: scrB Funciton: Sucrose hydrolase (EC 3.2.1.26) |
||||
| sacB-Bamb_3698-scrB | -73 | 5.8 | CTTCAAAACCGGTTTGGCCT | Bphy_6047 |
| -51 | 6 | GATCCAAACCGATTTGGAAA | ||