Orthologous regulated operons containing rhiF gene

Properties
Regulog:	RhiR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnogalacturonides utilization
Effector:	Rhamogalacturonate oligosaccharides
Phylum:	Proteobacteria/gamma

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -152 Score: 6.91744 Sequence: TTAATGCAAATTTGCATTGT Locus tag: ECA3750 Name: rhiX Funciton: hypothetical protein Locus tag: ECA3749 Name: rhiN Funciton: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) Locus tag: ECA3748 Name: rhiK Funciton: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein Locus tag: ECA3747 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: ECA3746 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1 Locus tag: ECA3745 Name: rhiR Funciton: Predicted rhamnogalacturonides utilization transcriptional regulator, LacI family
rhiX-rhiN-rhiK-rhiG-rhiF-rhiR	-152	6.9	TTAATGCAAATTTGCATTGT	ECA3750

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --