Orthologous regulated operons containing bglE gene
| Regulog: | BglR - Deinococcus-Thermus |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Deinococcus-Thermus |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Deinococcus deserti VCD115 | ||||
|
Position: -90
Score: 6.3397 Sequence: TCTTGACAGCGCTTTCAAAA
Locus tag: Deide_00590
Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: Deide_00580
Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component
Locus tag: Deide_00570
Name: bglF Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: Deide_00560
Name: bglG Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: Deide_00550
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) |
||||
| bglR-bglE-bglF-bglG-bglB | -90 | 6.3 | TCTTGACAGCGCTTTCAAAA | Deide_00590 |
| Deinococcus geothermalis DSM 11300 | ||||
|
Position: -147
Score: 5.55305 Sequence: GTTGACAAGCGCTTTCAAAG
Locus tag: Dgeo_2859
Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component
Locus tag: Dgeo_2860
Name: bglF Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: Dgeo_2861
Name: bglG Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: Dgeo_2862
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) |
||||
| bglE-bglF-bglG-bglB | -147 | 5.6 | GTTGACAAGCGCTTTCAAAG | Dgeo_2859 |
| Thermus thermophilus HB27 | ||||
|
Position: -21
Score: 6.31082 Sequence: TCTTGCAAGCGCTTTCAACA
Locus tag: TTP0038
Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: TTP0039
Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component
Locus tag: TTP0040
Name: bglF Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: TTP0041
Name: bglG Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: TTP0042
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) |
||||
| bglR-bglE-bglF-bglG-bglB | -21 | 6.3 | TCTTGCAAGCGCTTTCAACA | TTP0038 |