Orthologous regulated operons containing bglE gene

Properties
Regulog:	BglR - Deinococcus-Thermus
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Deinococcus-Thermus

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Deinococcus deserti VCD115
Position: -90 Score: 6.3397 Sequence: TCTTGACAGCGCTTTCAAAA Locus tag: Deide_00590 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: Deide_00580 Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component Locus tag: Deide_00570 Name: bglF Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: Deide_00560 Name: bglG Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: Deide_00550 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
bglR-bglE-bglF-bglG-bglB	-90	6.3	TCTTGACAGCGCTTTCAAAA	Deide_00590
Deinococcus geothermalis DSM 11300
Position: -147 Score: 5.55305 Sequence: GTTGACAAGCGCTTTCAAAG Locus tag: Dgeo_2859 Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component Locus tag: Dgeo_2860 Name: bglF Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: Dgeo_2861 Name: bglG Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: Dgeo_2862 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
bglE-bglF-bglG-bglB	-147	5.6	GTTGACAAGCGCTTTCAAAG	Dgeo_2859
Thermus thermophilus HB27
Position: -21 Score: 6.31082 Sequence: TCTTGCAAGCGCTTTCAACA Locus tag: TTP0038 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: TTP0039 Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component Locus tag: TTP0040 Name: bglF Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: TTP0041 Name: bglG Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: TTP0042 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
bglR-bglE-bglF-bglG-bglB	-21	6.3	TCTTGCAAGCGCTTTCAACA	TTP0038