Orthologous regulated operons containing cebE gene
Regulog: | CelR - Streptomycetaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Cellobiose utilization |
Effector: | Cellobiose |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Streptomyces avermitilis MA-4680 | ||||
Position: -134
Score: 6.69021 Sequence: TTGTGGGAGCGCTCCCACGG
Locus tag: SAV_5256
Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: SAV_5255
Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: SAV_5254
Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2 |
||||
cebE-cebF-cebG | -134 | 6.7 | TTGTGGGAGCGCTCCCACGG | SAV_5256 |
Streptomyces coelicolor A3(2) | ||||
Position: -147
Score: 6.64156 Sequence: TTGTGGGAGCGCTCCCACAC
Locus tag: SCO2795
Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: SCO2796
Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: SCO2797
Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2 |
||||
cebE-cebF-cebG | -147 | 6.6 | TTGTGGGAGCGCTCCCACAC | SCO2795 |
Streptomyces griseus subsp. griseus NBRC 13350 | ||||
Position: -55
Score: 5.48044 Sequence: ATTTGAGAGCGCTCTCAAGG
Locus tag: SGR_3212
Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: SGR_3213
Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: SGR_3214
Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2
Locus tag: SGR_3215
Name: bglC2 Funciton: Beta-glucosidase (EC 3.2.1.21) |
||||
cebE-cebF-cebG-bglC2 | -55 | 5.5 | ATTTGAGAGCGCTCTCAAGG | SGR_3212 |
Streptomyces scabiei 87.22 | ||||
Position: -133
Score: 6.69021 Sequence: TCGTGGGAGCGCTCCCACAG
Locus tag: SCAB_57751
Name: cebE Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: SCAB_57741
Name: cebF Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: SCAB_57731
Name: cebG Funciton: Cellobiose specific ABC transporter, permease protein 2 |
||||
cebE-cebF-cebG | -133 | 6.7 | TCGTGGGAGCGCTCCCACAG | SCAB_57751 |