Orthologous regulated operons containing gunA2 gene
| Regulog: | CelR - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces coelicolor A3(2) | ||||
|
Position: -87
Score: 6.02346 Sequence: AAGTGGGAGCGCTCCCATCA
Position: -61
Score: 5.33597 Sequence: AGTTGGGAGCGCTCCCGCAC
Locus tag: SCO1187
Name: gunA2 Funciton: Endoglucanase A (EC 3.2.1.4) |
||||
| gunA2 | -87 | 6 | AAGTGGGAGCGCTCCCATCA | SCO1187 |
| -61 | 5.3 | AGTTGGGAGCGCTCCCGCAC | ||
| Streptomyces scabiei 87.22 | ||||
|
Position: -85
Score: 6.07845 Sequence: AAATGGGAGCGCTCCCAAAG
Locus tag: SCAB_5981
Name: gunA2 Funciton: Endoglucanase A (EC 3.2.1.4) |
||||
| gunA2 | -85 | 6.1 | AAATGGGAGCGCTCCCAAAG | SCAB_5981 |