Orthologous regulated operons containing lamA1 gene
| Regulog: | CelR - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces avermitilis MA-4680 | ||||
|
Position: -60
Score: 5.68507 Sequence: TCTTGAGAGCGCTCTCAAGG
Locus tag: SAV_1764
Name: lamA1 Funciton: Predicted endo-1,3-beta-glucanase |
||||
| lamA1 | -60 | 5.7 | TCTTGAGAGCGCTCTCAAGG | SAV_1764 |
| Streptomyces coelicolor A3(2) | ||||
|
Position: -85
Score: 5.66818 Sequence: CTCTGAGAGCGCTCTCAGAA
Locus tag: SCO6665
Name: lamA1 Funciton: Predicted endo-1,3-beta-glucanase |
||||
| lamA1 | -85 | 5.7 | CTCTGAGAGCGCTCTCAGAA | SCO6665 |
| Streptomyces scabiei 87.22 | ||||
|
Position: -140
Score: 5.67662 Sequence: TTTTGAGAGCGCTCTCAGGA
Locus tag: SCAB_15711
Name: lamA1 Funciton: Predicted endo-1,3-beta-glucanase |
||||
| lamA1 | -140 | 5.7 | TTTTGAGAGCGCTCTCAGGA | SCAB_15711 |