Orthologous regulated operons containing SCO7637 gene
| Regulog: | CelR - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces coelicolor A3(2) | ||||
|
Position: 29
Score: 6.15972 Sequence: CTTTGGGAGCGCTCCCATCG
Locus tag: SCO7637
Name: SCO7637 Funciton: Secreted endoglucanase |
||||
| SCO7637 | 29 | 6.2 | CTTTGGGAGCGCTCCCATCG | SCO7637 |