Orthologous regulated operons containing SCO0643 gene
| Regulog: | CelR - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces coelicolor A3(2) | ||||
|
Position: -74
Score: 6.26602 Sequence: CCTTGGGAGCGCTCCCATGC
Locus tag: SCO0643
Name: SCO0643 Funciton: Putative secreted cellulose-binding protein |
||||
| SCO0643 | -74 | 6.3 | CCTTGGGAGCGCTCCCATGC | SCO0643 |