Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Ent638_2157 gene

Properties
Regulog: YcjW - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/gamma
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Enterobacter sp. 638
Position: -33
Score: 6.21293
Sequence: TCATGGGACCGCTACCACGC
Locus tag: Ent638_2157
Name: null
Funciton: Multiple sugar ABC transporter, ATP-binding protein
Ent638_2157 -33 6.2 TCATGGGACCGCTACCACGC Ent638_2157