Orthologous regulated operons containing ycjU gene
| Regulog: | YcjW - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -33
Score: 5.46814 Sequence: CAATGGGACCGCTACCAAAC
Locus tag: b1317
Name: ycjU Funciton: Beta-phosphoglucomutase (EC 5.4.2.6) |
||||
| ycjU | -33 | 5.5 | CAATGGGACCGCTACCAAAC | b1317 |