Orthologous regulated operons containing treF gene
Regulog: | TreR - Thermoanaerobacterales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Trehalose utilization |
Effector: | Trehalose |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Thermoanaerobacter ethanolicus X514 | ||||
Position: -74
Score: 6.61324 Sequence: AATTGTAAGCGCTTACAGTT
Locus tag: Teth514_2196
Name: treF Funciton: Predicted trehalose utilization ABC transporter, permease protein 1
Locus tag: Teth514_2195
Name: treG Funciton: Predicted trehalose utilization ABC transporter, permease protein 2
Locus tag: Teth514_2194
Name: treE Funciton: Predicted trehalose utilization ABC transporter, substrate-binding protein
Locus tag: Teth514_2193
Name: treP Funciton: Trehalose phosphorylase (EC 2.4.1.64) |
||||
treF-treG-treE-treP | -74 | 6.6 | AATTGTAAGCGCTTACAGTT | Teth514_2196 |
Thermoanaerobacter italicus Ab9 | ||||
Position: -77
Score: 6.20408 Sequence: GATTGTAAGCGCTTACAGTT
Locus tag: Thit_0761
Name: treF Funciton: Predicted trehalose utilization ABC transporter, permease protein 1
Locus tag: Thit_0762
Name: treG Funciton: Predicted trehalose utilization ABC transporter, permease protein 2
Locus tag: Thit_0763
Name: treE Funciton: Predicted trehalose utilization ABC transporter, substrate-binding protein
Locus tag: Thit_0764
Name: treP Funciton: Trehalose phosphorylase (EC 2.4.1.64) |
||||
treF-treG-treE-treP | -77 | 6.2 | GATTGTAAGCGCTTACAGTT | Thit_0761 |
Thermoanaerobacter tengcongensis MB4 | ||||
Position: -63
Score: 6.08643 Sequence: AACTGTAAGCGCTTTCAATA
Locus tag: TTE0804
Name: treF Funciton: Predicted trehalose utilization ABC transporter, permease protein 1
Locus tag: TTE0805
Name: treG Funciton: Predicted trehalose utilization ABC transporter, permease protein 2
Locus tag: TTE0806
Name: treE Funciton: Predicted trehalose utilization ABC transporter, substrate-binding protein
Locus tag: TTE0807
Name: treP Funciton: Trehalose phosphorylase (EC 2.4.1.64) |
||||
treF-treG-treE-treP | -63 | 6.1 | AACTGTAAGCGCTTTCAATA | TTE0804 |