Orthologous regulated operons containing treR gene
Regulog: | TreR - Thermoanaerobacterales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Trehalose utilization |
Effector: | Trehalose |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Thermoanaerobacter ethanolicus X514 | ||||
Position: -41
Score: 7.14005 Sequence: AACTGTAAGCGGTTACAGTA
Locus tag: Teth514_2197
Name: treR Funciton: Predicted trehalose utilization transcriptional regulator, LacI family |
||||
treR | -41 | 7.1 | AACTGTAAGCGGTTACAGTA | Teth514_2197 |
Thermoanaerobacter italicus Ab9 | ||||
Position: -41
Score: 7.14005 Sequence: AACTGTAAGCGGTTACAGTA
Locus tag: Thit_0760
Name: treR Funciton: Predicted trehalose utilization transcriptional regulator, LacI family |
||||
treR | -41 | 7.1 | AACTGTAAGCGGTTACAGTA | Thit_0760 |
Thermoanaerobacter tengcongensis MB4 | ||||
Position: -41
Score: 7.14005 Sequence: AACTGTAAGCGGTTACAGTA
Locus tag: TTE0803
Name: treR Funciton: Predicted trehalose utilization transcriptional regulator, LacI family |
||||
treR | -41 | 7.1 | AACTGTAAGCGGTTACAGTA | TTE0803 |