Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing kojP gene

Properties
Regulog: KojR - Bacillales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Kojibiose utilization
Effector: Kojibiose
Phylum: Firmicutes
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anoxybacillus flavithermus WK1
Position: -13
Score: 6.78028
Sequence: AATCCGAAACGTTTTGGGAA
Locus tag: Aflv_2025
Name: kojP
Funciton: Kojibiose phosphorylase (EC 2.4.1.230)
Locus tag: Aflv_2024
Name: pgmB
Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
Locus tag: Aflv_2023
Name: kojE
Funciton: Kojibiose ABC transporter, substrate-binding protein
Locus tag: Aflv_2022
Name: kojF
Funciton: Kojibiose ABC transporter, permease protein 1
Locus tag: Aflv_2021
Name: kojG
Funciton: Kojibiose ABC transporter, permease protein 2
kojP-pgmB-kojE-kojF-kojG -13 6.8 AATCCGAAACGTTTTGGGAA Aflv_2025