Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ycjO gene

Properties
Regulog: YcjW - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/gamma
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Enterobacter sp. 638
Position: -16
Score: 6.27905
Sequence: TCGTGGGACCGCTACCATGG
Locus tag: Ent638_2165
Name: sucP
Funciton: Putative sucrose phosphorylase (EC 2.4.1.7)
Locus tag: Ent638_2164
Name: ycjN
Funciton: Sugar ABC transport system, periplasmic binding protein YcjNN
Locus tag: Ent638_2163
Name: ycjO
Funciton: Sugar ABC transport system, permease protein YcjO
Locus tag: Ent638_2162
Name: ycjP
Funciton: Sugar ABC transport system, permease protein YcjP
Locus tag: Ent638_2161
Name: ycjQ
Funciton: Uncharacterized zinc-type alcohol dehydrogenase-like protein YcjQ
Locus tag: Ent638_2160
Name: ycjR
Funciton: Sugar phosphate isomerases/epimerases family protein YcjR
Locus tag: Ent638_2159
Name: ycjS
Funciton: Uncharacterized oxidoreductase YcjS
Locus tag: Ent638_2158
Name: ycjT
Funciton: Uncharacterized glycosyl hydrolase YcjT EC=3.2.1.-
sucP-ycjN-ycjO-ycjP-ycjQ-ycjR-ycjS-ycjT -16 6.3 TCGTGGGACCGCTACCATGG Ent638_2165
Escherichia coli str. K-12 substr. MG1655
Position: -29
Score: 6.27905
Sequence: TCATGGGACCGCTACCACGG
Locus tag: b1309
Name: sucP
Funciton: Putative sucrose phosphorylase (EC 2.4.1.7)
Locus tag: b1310
Name: ycjN
Funciton: Sugar ABC transport system, periplasmic binding protein YcjNN
Locus tag: b1311
Name: ycjO
Funciton: Sugar ABC transport system, permease protein YcjO
Locus tag: b1312
Name: ycjP
Funciton: Sugar ABC transport system, permease protein YcjP
Locus tag: b1313
Name: ycjQ
Funciton: Uncharacterized zinc-type alcohol dehydrogenase-like protein YcjQ
Locus tag: b1314
Name: ycjR
Funciton: Sugar phosphate isomerases/epimerases family protein YcjR
Locus tag: b1315
Name: ycjS
Funciton: Uncharacterized oxidoreductase YcjS
Locus tag: b1316
Name: ycjT
Funciton: Uncharacterized glycosyl hydrolase YcjT EC=3.2.1.-
sucP-ycjN-ycjO-ycjP-ycjQ-ycjR-ycjS-ycjT -29 6.3 TCATGGGACCGCTACCACGG b1309