Orthologous regulated operons containing ycjN gene
| Regulog: | YcjW - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Enterobacter sp. 638 | ||||
|
Position: -16
Score: 6.27905 Sequence: TCGTGGGACCGCTACCATGG
Locus tag: Ent638_2165
Name: sucP Funciton: Putative sucrose phosphorylase (EC 2.4.1.7)
Locus tag: Ent638_2164
Name: ycjN Funciton: Sugar ABC transport system, periplasmic binding protein YcjNN
Locus tag: Ent638_2163
Name: ycjO Funciton: Sugar ABC transport system, permease protein YcjO
Locus tag: Ent638_2162
Name: ycjP Funciton: Sugar ABC transport system, permease protein YcjP
Locus tag: Ent638_2161
Name: ycjQ Funciton: Uncharacterized zinc-type alcohol dehydrogenase-like protein YcjQ
Locus tag: Ent638_2160
Name: ycjR Funciton: Sugar phosphate isomerases/epimerases family protein YcjR
Locus tag: Ent638_2159
Name: ycjS Funciton: Uncharacterized oxidoreductase YcjS
Locus tag: Ent638_2158
Name: ycjT Funciton: Uncharacterized glycosyl hydrolase YcjT EC=3.2.1.- |
||||
| sucP-ycjN-ycjO-ycjP-ycjQ-ycjR-ycjS-ycjT | -16 | 6.3 | TCGTGGGACCGCTACCATGG | Ent638_2165 |
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -29
Score: 6.27905 Sequence: TCATGGGACCGCTACCACGG
Locus tag: b1309
Name: sucP Funciton: Putative sucrose phosphorylase (EC 2.4.1.7)
Locus tag: b1310
Name: ycjN Funciton: Sugar ABC transport system, periplasmic binding protein YcjNN
Locus tag: b1311
Name: ycjO Funciton: Sugar ABC transport system, permease protein YcjO
Locus tag: b1312
Name: ycjP Funciton: Sugar ABC transport system, permease protein YcjP
Locus tag: b1313
Name: ycjQ Funciton: Uncharacterized zinc-type alcohol dehydrogenase-like protein YcjQ
Locus tag: b1314
Name: ycjR Funciton: Sugar phosphate isomerases/epimerases family protein YcjR
Locus tag: b1315
Name: ycjS Funciton: Uncharacterized oxidoreductase YcjS
Locus tag: b1316
Name: ycjT Funciton: Uncharacterized glycosyl hydrolase YcjT EC=3.2.1.- |
||||
| sucP-ycjN-ycjO-ycjP-ycjQ-ycjR-ycjS-ycjT | -29 | 6.3 | TCATGGGACCGCTACCACGG | b1309 |