Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hsp20-2 gene

Properties
Regulog: Phr - Methanomicrobiales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heat shock response
Effector:
Phylum: Euryarchaeota
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Candidatus Methanoregula boonei 6A8
Position: -20
Score: 5.38356
Sequence: AACACTAACATAAAGTAAACATG
Locus tag: Mboo_1711
Name: phr
Funciton: Heat shock response regulator Phr, ArsR family
Locus tag: Mboo_1710
Name: hsp20-2
Funciton: Small heat shock protein 20
phr-hsp20-2 -20 5.4 AACACTAACATAAAGTAAACATG Mboo_1711
Candidatus Methanosphaerula palustris E1-9c
Position: -21
Score: 5.42191
Sequence: CTCCCTAACATAAAGTAAATAAT
Locus tag: Mpal_2059
Name: phr
Funciton: Heat shock response regulator Phr, ArsR family
Locus tag: Mpal_2058
Name: hsp20-2
Funciton: Small heat shock protein 20
phr-hsp20-2 -21 5.4 CTCCCTAACATAAAGTAAATAAT Mpal_2059
Methanoculleus marisnigri JR1
Position: -20
Score: 5.47818
Sequence: ATCACTAACATTTAGTAAATATG
Locus tag: Memar_1567
Name: phr
Funciton: Heat shock response regulator Phr, ArsR family
Locus tag: Memar_1566
Name: hsp20-2
Funciton: Small heat shock protein 20
phr-hsp20-2 -20 5.5 ATCACTAACATTTAGTAAATATG Memar_1567
Methanospirillum hungatei JF-1
Position: -21
Score: 5.66575
Sequence: TTCACTAACATAGAGTTAGTGAT
Locus tag: Mhun_2633
Name: phr
Funciton: Heat shock response regulator Phr, ArsR family
Locus tag: Mhun_2634
Name: hsp20-2
Funciton: Small heat shock protein 20
phr-hsp20-2 -21 5.7 TTCACTAACATAGAGTTAGTGAT Mhun_2633
© 2009-2020 RegPrecise