Orthologous regulated operons containing COG3137 gene
Regulog: | XCC2209 - Xanthomonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Xanthomonas axonopodis pv. citri str. 306 | ||||
Position: -49
Score: 5.64343 Sequence: TCATGAAATCGCTTTCACCC
Locus tag: XAC0623
Name: COG3137 Funciton: Putative salt-induced outer membrane protein |
||||
COG3137 | -49 | 5.6 | TCATGAAATCGCTTTCACCC | XAC0623 |
Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
Position: -55
Score: 5.54814 Sequence: TCATGAAATCGCTTTCACCT
Locus tag: XCC3510
Name: COG3137 Funciton: Putative salt-induced outer membrane protein |
||||
COG3137 | -55 | 5.5 | TCATGAAATCGCTTTCACCT | XCC3510 |