Orthologous regulated operons containing PF10947 gene
| Regulog: | XCC2209 - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -36
Score: 5.69804 Sequence: TCATGAAAACGTTTTCTCAC
Locus tag: Smlt4137
Name: PF10947 Funciton: hypothetical protein |
||||
| PF10947 | -36 | 5.7 | TCATGAAAACGTTTTCTCAC | Smlt4137 |
| Xanthomonas axonopodis pv. citri str. 306 | ||||
|
Position: -32
Score: 5.74942 Sequence: TCATGTAAACGTTTACAACT
Locus tag: XAC4357
Name: PF10947 Funciton: hypothetical protein |
||||
| PF10947 | -32 | 5.7 | TCATGTAAACGTTTACAACT | XAC4357 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
|
Position: -33
Score: 5.61934 Sequence: TCATGTAAACGCTTTCAATC
Locus tag: XCC4223
Name: PF10947 Funciton: hypothetical protein |
||||
| PF10947 | -33 | 5.6 | TCATGTAAACGCTTTCAATC | XCC4223 |