Orthologous regulated operons containing omp2 gene
Regulog: | XCC2209 - Xanthomonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Stenotrophomonas maltophilia K279a | ||||
Position: -42
Score: 5.51813 Sequence: ATCTGAAAGCGATTACACCC
Locus tag: Smlt1175
Name: omp2 Funciton: Putative carbohydrate outer membrane transporter, TonB-dependent |
||||
omp2 | -42 | 5.5 | ATCTGAAAGCGATTACACCC | Smlt1175 |
Xanthomonas axonopodis pv. citri str. 306 | ||||
Position: -118
Score: 5.34505 Sequence: GGATGGAATCGATTTCATCG
Locus tag: XAC2600
Name: omp2 Funciton: Putative carbohydrate outer membrane transporter, TonB-dependent |
||||
omp2 | -118 | 5.3 | GGATGGAATCGATTTCATCG | XAC2600 |
Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
Position: -124
Score: 5.06421 Sequence: CAGTGGAATCGATTTCAGCA
Locus tag: XCC2469
Name: omp2 Funciton: Putative carbohydrate outer membrane transporter, TonB-dependent |
||||
omp2 | -124 | 5.1 | CAGTGGAATCGATTTCAGCA | XCC2469 |