Orthologous regulated operons containing ugpC gene
| Regulog: | XCC2209 - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -148
Score: 5.7533 Sequence: ACGTGAAAACGTTTACATGG
Locus tag: Smlt1794
Name: ugpC Funciton: Multiple sugar ABC transporter, ATP-binding protein |
||||
| ugpC | -148 | 5.8 | ACGTGAAAACGTTTACATGG | Smlt1794 |
| Xanthomonas axonopodis pv. citri str. 306 | ||||
|
Position: -130
Score: 5.80311 Sequence: ATGTGAAAACGATTACATGT
Locus tag: XAC2072
Name: ugpC Funciton: Multiple sugar ABC transporter, ATP-binding protein |
||||
| ugpC | -130 | 5.8 | ATGTGAAAACGATTACATGT | XAC2072 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
|
Position: -130
Score: 5.80311 Sequence: ATGTGAAAACGATTACATGT
Locus tag: XCC2135
Name: ugpC Funciton: Multiple sugar ABC transporter, ATP-binding protein |
||||
| ugpC | -130 | 5.8 | ATGTGAAAACGATTACATGT | XCC2135 |