Orthologous regulated operons containing ugpC gene
Regulog: | XCC2209 - Xanthomonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Stenotrophomonas maltophilia K279a | ||||
Position: -148
Score: 5.7533 Sequence: ACGTGAAAACGTTTACATGG
Locus tag: Smlt1794
Name: ugpC Funciton: Multiple sugar ABC transporter, ATP-binding protein |
||||
ugpC | -148 | 5.8 | ACGTGAAAACGTTTACATGG | Smlt1794 |
Xanthomonas axonopodis pv. citri str. 306 | ||||
Position: -130
Score: 5.80311 Sequence: ATGTGAAAACGATTACATGT
Locus tag: XAC2072
Name: ugpC Funciton: Multiple sugar ABC transporter, ATP-binding protein |
||||
ugpC | -130 | 5.8 | ATGTGAAAACGATTACATGT | XAC2072 |
Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
Position: -130
Score: 5.80311 Sequence: ATGTGAAAACGATTACATGT
Locus tag: XCC2135
Name: ugpC Funciton: Multiple sugar ABC transporter, ATP-binding protein |
||||
ugpC | -130 | 5.8 | ATGTGAAAACGATTACATGT | XCC2135 |