Orthologous regulated operons containing XCC2209 gene
Regulog: | XCC2209 - Xanthomonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Stenotrophomonas maltophilia K279a | ||||
Position: -46
Score: 5.65592 Sequence: AGATGGAAACGCTTACATTC
Locus tag: Smlt3255
Name: XCC2209 Funciton: Transcriptional regulator, LacI family
Locus tag: Smlt3254
Name: omp Funciton: Putative carbohydrate outer membrane transporter, TonB-dependent |
||||
XCC2209-omp | -46 | 5.7 | AGATGGAAACGCTTACATTC | Smlt3255 |
Xanthomonas axonopodis pv. citri str. 306 | ||||
Position: -106
Score: 5.56585 Sequence: ATCTGTAAGCGTTTTCACGC
Position: -60
Score: 5.52803 Sequence: GTATGAAAACGCTTACAGTC
Locus tag: XAC2313
Name: XCC2209 Funciton: Transcriptional regulator, LacI family
Locus tag: XAC2312
Name: omp Funciton: Putative carbohydrate outer membrane transporter, TonB-dependent |
||||
XCC2209-omp | -106 | 5.6 | ATCTGTAAGCGTTTTCACGC | XAC2313 |
-60 | 5.5 | GTATGAAAACGCTTACAGTC | ||
Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
Position: -107
Score: 5.50786 Sequence: ATCTGTAAGCGTTTTCACAA
Position: -61
Score: 5.52803 Sequence: GTATGAAAACGCTTACAGTC
Locus tag: XCC2209
Name: XCC2209 Funciton: Transcriptional regulator, LacI family
Locus tag: XCC2208
Name: omp Funciton: Putative carbohydrate outer membrane transporter, TonB-dependent |
||||
XCC2209-omp | -107 | 5.5 | ATCTGTAAGCGTTTTCACAA | XCC2209 |
-61 | 5.5 | GTATGAAAACGCTTACAGTC |