Orthologous regulated operons containing ugpB gene
Regulog: | XCC2209 - Xanthomonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Stenotrophomonas maltophilia K279a | ||||
Position: -31
Score: 5.61436 Sequence: CCTTGTAAACGATTTCAGAT
Locus tag: Smlt3253
Name: COG5368 Funciton: Hypothetical sugar hydrolase
Locus tag: Smlt3252
Name: ugpB Funciton: Sugar ABC transporter, periplasmic sugar-binding protein
Locus tag: Smlt3251
Name: ugpA Funciton: Sugar ABC transporter, sugar permease protein 1
Locus tag: Smlt3250
Name: ugpE Funciton: Sugar ABC transporter, sugar permease protein 2
Locus tag: Smlt3249
Name: COG3408 Funciton: Hypothetical sugar binding and hydrolysis protein |
||||
COG5368-ugpB-ugpA-ugpE-COG3408 | -31 | 5.6 | CCTTGTAAACGATTTCAGAT | Smlt3253 |
Xanthomonas axonopodis pv. citri str. 306 | ||||
Position: -31
Score: 5.92623 Sequence: AGATGTAATCGATTACACAC
Locus tag: XAC2311
Name: COG5368 Funciton: Hypothetical sugar hydrolase
Locus tag: XAC2310
Name: ugpB Funciton: Sugar ABC transporter, periplasmic sugar-binding protein
Locus tag: XAC2309
Name: ugpA Funciton: Sugar ABC transporter, sugar permease protein 1
Locus tag: XAC2308
Name: ugpE Funciton: Sugar ABC transporter, sugar permease protein 2
Locus tag: XAC2307
Name: COG3408 Funciton: Hypothetical sugar binding and hydrolysis protein |
||||
COG5368-ugpB-ugpA-ugpE-COG3408 | -31 | 5.9 | AGATGTAATCGATTACACAC | XAC2311 |
Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
Position: -31
Score: 5.86824 Sequence: AGATGTAATCGATTACACGA
Locus tag: XCC2207
Name: COG5368 Funciton: Hypothetical sugar hydrolase
Locus tag: XCC2206
Name: ugpB Funciton: Sugar ABC transporter, periplasmic sugar-binding protein
Locus tag: XCC2205
Name: ugpA Funciton: Sugar ABC transporter, sugar permease protein 1
Locus tag: XCC2204
Name: ugpE Funciton: Sugar ABC transporter, sugar permease protein 2
Locus tag: XCC2203
Name: COG3408 Funciton: Hypothetical sugar binding and hydrolysis protein |
||||
COG5368-ugpB-ugpA-ugpE-COG3408 | -31 | 5.9 | AGATGTAATCGATTACACGA | XCC2207 |