Orthologous regulated operons containing bglX gene
Regulog: | XCC2209 - Xanthomonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Stenotrophomonas maltophilia K279a | ||||
Position: -30
Score: 5.69664 Sequence: GCTTGTAAACGTTTTCATCA
Locus tag: Smlt0449
Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21) |
||||
bglX | -30 | 5.7 | GCTTGTAAACGTTTTCATCA | Smlt0449 |
Xanthomonas axonopodis pv. citri str. 306 | ||||
Position: -27
Score: 5.75767 Sequence: CCATGTAAACGTTTTCTCAA
Locus tag: XAC3869
Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21) |
||||
bglX | -27 | 5.8 | CCATGTAAACGTTTTCTCAA | XAC3869 |
Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
Position: -27
Score: 5.75767 Sequence: CCATGTAAACGTTTTCTCAA
Locus tag: XCC3814
Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21) |
||||
bglX | -27 | 5.8 | CCATGTAAACGTTTTCTCAA | XCC3814 |