Orthologous regulated operons containing scrK gene

Properties
Regulog:	ScrR - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Phylum:	Proteobacteria/Gamma

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: -66 Score: 6.59612 Sequence: TGGCTAAAACGGTTTAGCTG Locus tag: AHA_2980 Name: scrK Funciton: Fructokinase (EC 2.7.1.4) Locus tag: AHA_2979 Name: scrA Funciton: PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69) Locus tag: AHA_2978 Name: scrB Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) Locus tag: AHA_2977 Name: scrR Funciton: Sucrose operon repressor ScrR, LacI family
scrK-scrA-scrB-scrR	-66	6.6	TGGCTAAAACGGTTTAGCTG	AHA_2980
Aeromonas salmonicida subsp. salmonicida A449
Position: -108 Score: 6.71088 Sequence: TAGCTAAATCGGTTTAGCTG Locus tag: ASA_2993 Name: scrK Funciton: Fructokinase (EC 2.7.1.4) Locus tag: ASA_2992 Name: scrA Funciton: PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69) Locus tag: ASA_2991 Name: scrB Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) Locus tag: ASA_2990 Name: scrR Funciton: Sucrose operon repressor ScrR, LacI family
scrK-scrA-scrB-scrR	-108	6.7	TAGCTAAATCGGTTTAGCTG	ASA_2993

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --