Orthologous regulated operons containing GHTCC_010100003724 gene
| Regulog: | BglR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Glaciecola sp. HTCC2999 | ||||
|
Position: -99
Score: 6.68448 Sequence: AAATGTAAGCGCTTACATTT
Locus tag: GHTCC_010100003724
Name: GHTCC_010100003724 Funciton: Endo-1,3(4)-beta-glucanase |
||||
| GHTCC_010100003724 | -99 | 6.7 | AAATGTAAGCGCTTACATTT | GHTCC_010100003724 |