Orthologous regulated operons containing omp(Bgl)1 gene
| Regulog: | BglR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alteromonadales bacterium TW-7 | ||||
|
Position: -140
Score: 4.98484 Sequence: TTCTGGAAGCGCTTCCACAT
Position: -100
Score: 4.71716 Sequence: TTCTGGAAGCGCTTCCACAC
Locus tag: ATW7_07974
Name: omp(Bgl)1 Funciton: Predicted beta-glucoside specific TonB-dependent outer membrane receptor
Locus tag: ATW7_07979
Name: trpH1 Funciton: putative tryptophan halogenase
Locus tag: ATW7_07984
Name: trpH2 Funciton: putative tryptophan halogenase |
||||
| omp(Bgl)1-trpH1-trpH2 | -140 | 5 | TTCTGGAAGCGCTTCCACAT | ATW7_07974 |
| -100 | 4.7 | TTCTGGAAGCGCTTCCACAC | ||
| Colwellia psychrerythraea 34H | ||||
|
Position: -449
Score: 6.52281 Sequence: AAATGTAAGCGCTTACAAAT
Position: -240
Score: 6.76645 Sequence: TTATGTAAGCGCTTACATTT
Position: -165
Score: 6.20506 Sequence: TTATGTAAGCGCTTACACCA
Locus tag: CPS_3698
Name: omp(Bgl)1 Funciton: Predicted beta-glucoside specific TonB-dependent outer membrane receptor
Locus tag: CPS_3699
Name: trpH1 Funciton: putative tryptophan halogenase
Locus tag: CPS_3700
Name: trpH2 Funciton: putative tryptophan halogenase |
||||
| omp(Bgl)1-trpH1-trpH2 | -449 | 6.5 | AAATGTAAGCGCTTACAAAT | CPS_3698 |
| -240 | 6.8 | TTATGTAAGCGCTTACATTT | ||
| -165 | 6.2 | TTATGTAAGCGCTTACACCA | ||