Orthologous regulated operons containing GHTCC_010100001624 gene
| Regulog: | BglR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Glaciecola sp. HTCC2999 | ||||
|
Position: -103
Score: 6.25821 Sequence: AAATGAAAGCGCTTTCATTG
Locus tag: GHTCC_010100001609
Name: bglA1 Funciton: Cytoplasmic beta-glucosidase (EC 3.2.1.21)
Locus tag: GHTCC_010100001614
Name: bglR Funciton: Transcriptional regulator of beta-glucosides utilization, LacI family
Locus tag: GHTCC_010100001619
Name: bglT3 Funciton: Predicted beta-glucoside transporter, MFS family
Locus tag: GHTCC_010100001624
Name: null Funciton: TonB-dependent receptor |
||||
| bglA1-bglR-bglT3-GHTCC_010100001624 | -103 | 6.3 | AAATGAAAGCGCTTTCATTG | GHTCC_010100001609 |