Orthologous regulated operons containing glk gene
| Regulog: | BglR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Colwellia psychrerythraea 34H | ||||
|
Position: -126
Score: 6.21061 Sequence: AAATGTAAGCGCTTACATCC
Position: -71
Score: 5.98401 Sequence: TTTTGTAAGCGCTCACATAA
Locus tag: CPS_3706
Name: bglA1 Funciton: Cytoplasmic beta-glucosidase (EC 3.2.1.21)
Locus tag: CPS_3707
Name: bglT2 Funciton: Predicted beta-glucoside transporter, MFS family
Locus tag: CPS_3708
Name: bglT Funciton: Predicted beta-glucoside transporter, GPH family
Locus tag: CPS_3709
Name: bglR Funciton: Transcriptional regulator of beta-glucosides utilization, LacI family
Locus tag: CPS_3710
Name: glk Funciton: Glucokinase, ROK family (EC 2.7.1.2) |
||||
| bglA1-bglT2-bglT-bglR-glk | -126 | 6.2 | AAATGTAAGCGCTTACATCC | CPS_3706 |
| -71 | 6 | TTTTGTAAGCGCTCACATAA | ||