Orthologous regulated operons containing BH1246 gene

Properties
Regulog:	BH1250 - Bacillales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Firmicutes

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Anoxybacillus flavithermus WK1
Position: -56 Score: 6.26112 Sequence: ATATGAAAACGATTTCATTC Locus tag: Aflv_2275 Name: BH1250 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: Aflv_2274 Name: BH1244 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: Aflv_2273 Name: BH1245 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: Aflv_2272 Name: BH1246 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: Aflv_2271 Name: BH2903 Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
BH1250-BH1244-BH1245-BH1246-BH2903	-56	6.3	ATATGAAAACGATTTCATTC	Aflv_2275
Bacillus halodurans C-125
Position: -102 Score: 5.6098 Sequence: ATATGAGAACGATTCCATAG Position: -32 Score: 5.28819 Sequence: ATGTGAAATCGATTCCATAT Locus tag: BH1244 Name: BH1244 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: BH1245 Name: BH1245 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: BH1246 Name: BH1246 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: BH1247 Name: BH1247 Funciton: Conserved hypothetical protein Locus tag: BH1248 Name: BH1248 Funciton: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) Locus tag: BH1249 Name: BH1249 Funciton: Inosose isomerase (EC 5.3.99.-) Locus tag: BH1250 Name: BH1250 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
BH1244-BH1245-BH1246-BH1247-BH1248-BH1249-BH1250	-102	5.6	ATATGAGAACGATTCCATAG	BH1244
	-32	5.3	ATGTGAAATCGATTCCATAT