Orthologous regulated operons containing BH1250 gene
Regulog: | BH1250 - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Anoxybacillus flavithermus WK1 | ||||
Position: -56
Score: 6.26112 Sequence: ATATGAAAACGATTTCATTC
Locus tag: Aflv_2275
Name: BH1250 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: Aflv_2274
Name: BH1244 Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: Aflv_2273
Name: BH1245 Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: Aflv_2272
Name: BH1246 Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: Aflv_2271
Name: BH2903 Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10) |
||||
BH1250-BH1244-BH1245-BH1246-BH2903 | -56 | 6.3 | ATATGAAAACGATTTCATTC | Aflv_2275 |
Bacillus cereus ATCC 14579 | ||||
Position: -96
Score: 5.89714 Sequence: TTAAGAAAACGTTTTCATGC
Locus tag: BC1083
Name: BH1250 Funciton: Predicted sugar utilization transcriptional regulator, LacI family |
||||
BH1250 | -96 | 5.9 | TTAAGAAAACGTTTTCATGC | BC1083 |
Bacillus clausii KSM-K16 | ||||
Position: -33
Score: 5.86697 Sequence: AAATGAGAACGTTTTCAATA
Locus tag: ABC1572
Name: BH1250 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: ABC1573
Name: BH1247 Funciton: Conserved hypothetical protein
Locus tag: ABC1574
Name: ABC1574 Funciton: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) |
||||
BH1250-BH1247-ABC1574 | -33 | 5.9 | AAATGAGAACGTTTTCAATA | ABC1572 |
Bacillus halodurans C-125 | ||||
Position: -102
Score: 5.6098 Sequence: ATATGAGAACGATTCCATAG
Position: -32
Score: 5.28819 Sequence: ATGTGAAATCGATTCCATAT
Locus tag: BH1244
Name: BH1244 Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: BH1245
Name: BH1245 Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: BH1246
Name: BH1246 Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: BH1247
Name: BH1247 Funciton: Conserved hypothetical protein
Locus tag: BH1248
Name: BH1248 Funciton: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
Locus tag: BH1249
Name: BH1249 Funciton: Inosose isomerase (EC 5.3.99.-)
Locus tag: BH1250
Name: BH1250 Funciton: Predicted sugar utilization transcriptional regulator, LacI family |
||||
BH1244-BH1245-BH1246-BH1247-BH1248-BH1249-BH1250 | -102 | 5.6 | ATATGAGAACGATTCCATAG | BH1244 |
-32 | 5.3 | ATGTGAAATCGATTCCATAT |