Orthologous regulated operons containing RSc1794 gene
| Regulog: | RSc1790 - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Cupriavidus taiwanensis | ||||
|
Position: -74
Score: 6.58457 Sequence: GAATGAAAACGTTTTCATTT
Locus tag: RALTA_A1435
Name: RSc1790 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: RALTA_A1434
Name: RSc1791 Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: RALTA_A1433
Name: RSc1792 Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: RALTA_A1432
Name: RSc1793 Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: RALTA_A1431
Name: RSc1794 Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: RALTA_A1430
Name: RSc1795 Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17) |
||||
| RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795 | -74 | 6.6 | GAATGAAAACGTTTTCATTT | RALTA_A1435 |
| Ralstonia eutropha H16 | ||||
|
Position: -2
Score: 6.69266 Sequence: CAATGAAAACGTTTTCATCC
Locus tag: H16_B1599
Name: RSc1790 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: H16_B1600
Name: RSc1791 Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: H16_B1601
Name: RSc1792 Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: H16_B1602
Name: RSc1793 Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: H16_B1603
Name: RSc1794 Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: H16_B1604
Name: RSc1795 Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17) |
||||
| RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795 | -2 | 6.7 | CAATGAAAACGTTTTCATCC | H16_B1599 |
| Ralstonia metallidurans CH34 | ||||
|
Position: -52
Score: 6.69266 Sequence: CAATGAAAACGTTTTCATCG
Locus tag: Rmet_4839
Name: RSc1790 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: Rmet_4840
Name: RSc1791 Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: Rmet_4841
Name: RSc1792 Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: Rmet_4842
Name: RSc1793 Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: Rmet_4843
Name: RSc1794 Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: Rmet_4844
Name: RSc1795 Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17) |
||||
| RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795 | -52 | 6.7 | CAATGAAAACGTTTTCATCG | Rmet_4839 |
| Ralstonia pickettii 12J | ||||
|
Position: -35
Score: 6.02252 Sequence: GCATGTAAACGTTTACACCT
Locus tag: Rpic_1419
Name: RSc1790 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: Rpic_1418
Name: RSc1791 Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: Rpic_1417
Name: RSc1792 Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: Rpic_1416
Name: RSc1793 Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: Rpic_1415
Name: RSc1794 Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: Rpic_1414
Name: RSc1795 Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17) |
||||
| RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795 | -35 | 6 | GCATGTAAACGTTTACACCT | Rpic_1419 |
| Ralstonia solanacearum GMI1000 | ||||
|
Position: -38
Score: 6.13062 Sequence: CGATGTAAACGTTTACAAGC
Locus tag: RS04189
Name: RSc1790 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
Locus tag: RS04190
Name: RSc1791 Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: RS04191
Name: RSc1792 Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: RS04192
Name: RSc1793 Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: RS04193
Name: RSc1794 Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: RS04195
Name: RSc1795 Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17) |
||||
| RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795 | -38 | 6.1 | CGATGTAAACGTTTACAAGC | RS04189 |