Orthologous regulated operons containing RSc1793 gene

Properties
Regulog:	RSc1790 - Ralstonia
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/beta

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cupriavidus taiwanensis
Position: -74 Score: 6.58457 Sequence: GAATGAAAACGTTTTCATTT Locus tag: RALTA_A1435 Name: RSc1790 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: RALTA_A1434 Name: RSc1791 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: RALTA_A1433 Name: RSc1792 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: RALTA_A1432 Name: RSc1793 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: RALTA_A1431 Name: RSc1794 Funciton: Predicted sugar ABC transporter, ATP-binding protein Locus tag: RALTA_A1430 Name: RSc1795 Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795	-74	6.6	GAATGAAAACGTTTTCATTT	RALTA_A1435
Ralstonia eutropha H16
Position: -2 Score: 6.69266 Sequence: CAATGAAAACGTTTTCATCC Locus tag: H16_B1599 Name: RSc1790 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: H16_B1600 Name: RSc1791 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: H16_B1601 Name: RSc1792 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: H16_B1602 Name: RSc1793 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: H16_B1603 Name: RSc1794 Funciton: Predicted sugar ABC transporter, ATP-binding protein Locus tag: H16_B1604 Name: RSc1795 Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795	-2	6.7	CAATGAAAACGTTTTCATCC	H16_B1599
Ralstonia metallidurans CH34
Position: -52 Score: 6.69266 Sequence: CAATGAAAACGTTTTCATCG Locus tag: Rmet_4839 Name: RSc1790 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: Rmet_4840 Name: RSc1791 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: Rmet_4841 Name: RSc1792 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: Rmet_4842 Name: RSc1793 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: Rmet_4843 Name: RSc1794 Funciton: Predicted sugar ABC transporter, ATP-binding protein Locus tag: Rmet_4844 Name: RSc1795 Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795	-52	6.7	CAATGAAAACGTTTTCATCG	Rmet_4839
Ralstonia pickettii 12J
Position: -35 Score: 6.02252 Sequence: GCATGTAAACGTTTACACCT Locus tag: Rpic_1419 Name: RSc1790 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: Rpic_1418 Name: RSc1791 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: Rpic_1417 Name: RSc1792 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: Rpic_1416 Name: RSc1793 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: Rpic_1415 Name: RSc1794 Funciton: Predicted sugar ABC transporter, ATP-binding protein Locus tag: Rpic_1414 Name: RSc1795 Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795	-35	6	GCATGTAAACGTTTACACCT	Rpic_1419
Ralstonia solanacearum GMI1000
Position: -38 Score: 6.13062 Sequence: CGATGTAAACGTTTACAAGC Locus tag: RS04189 Name: RSc1790 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: RS04190 Name: RSc1791 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: RS04191 Name: RSc1792 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: RS04192 Name: RSc1793 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: RS04193 Name: RSc1794 Funciton: Predicted sugar ABC transporter, ATP-binding protein Locus tag: RS04195 Name: RSc1795 Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
RSc1790-RSc1791-RSc1792-RSc1793-RSc1794-RSc1795	-38	6.1	CGATGTAAACGTTTACAAGC	RS04189