Orthologous regulated operons containing amyB gene
| Regulog: | MalR2 - Thermoanaerobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Anaerocellum thermophilum DSM 6725 | ||||
|
Position: -91
Score: 5.83288 Sequence: TTATGCAAACATTTGCATTA
Locus tag: Athe_2579
Name: amyB Funciton: Neopullulanase (EC 3.2.1.135) |
||||
| amyB | -91 | 5.8 | TTATGCAAACATTTGCATTA | Athe_2579 |
| Caldicellulosiruptor saccharolyticus DSM 8903 | ||||
|
Position: -93
Score: 5.83288 Sequence: TTATGCAAACATTTGCATTA
Locus tag: Csac_0426
Name: amyB Funciton: Neopullulanase (EC 3.2.1.135) |
||||
| amyB | -93 | 5.8 | TTATGCAAACATTTGCATTA | Csac_0426 |