Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing glgP1 gene

Properties
Regulog: MalR2 - Thermoanaerobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anaerocellum thermophilum DSM 6725
Position: -45
Score: 5.84221
Sequence: AAGAGCAAACGATTGCACAT
Locus tag: Athe_2578
Name: malF
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: Athe_2577
Name: malG
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: Athe_2576
Name: glgP1
Funciton: Glycogen phosphorylase (EC 2.4.1.1)
Locus tag: Athe_2575
Name: malR2
Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
Locus tag: Athe_2574
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
malF-malG-glgP1-malR2-malE -45 5.8 AAGAGCAAACGATTGCACAT Athe_2578
Caldicellulosiruptor saccharolyticus DSM 8903
Position: -46
Score: 5.63904
Sequence: AAGAGCAAACGATTGCACAC
Locus tag: Csac_0427
Name: malF
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: Csac_0428
Name: malG
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: Csac_0429
Name: glgP1
Funciton: Glycogen phosphorylase (EC 2.4.1.1)
Locus tag: Csac_0430
Name: malR2
Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
Locus tag: Csac_0431
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
malF-malG-glgP1-malR2-malE -46 5.6 AAGAGCAAACGATTGCACAC Csac_0427