Orthologous regulated operons containing malR2 gene
| Regulog: | MalR2 - Thermoanaerobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Anaerocellum thermophilum DSM 6725 | ||||
|
Position: -45
Score: 5.84221 Sequence: AAGAGCAAACGATTGCACAT
Locus tag: Athe_2578
Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: Athe_2577
Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: Athe_2576
Name: glgP1 Funciton: Glycogen phosphorylase (EC 2.4.1.1)
Locus tag: Athe_2575
Name: malR2 Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
Locus tag: Athe_2574
Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein |
||||
| malF-malG-glgP1-malR2-malE | -45 | 5.8 | AAGAGCAAACGATTGCACAT | Athe_2578 |
| Caldicellulosiruptor saccharolyticus DSM 8903 | ||||
|
Position: -46
Score: 5.63904 Sequence: AAGAGCAAACGATTGCACAC
Locus tag: Csac_0427
Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: Csac_0428
Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: Csac_0429
Name: glgP1 Funciton: Glycogen phosphorylase (EC 2.4.1.1)
Locus tag: Csac_0430
Name: malR2 Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
Locus tag: Csac_0431
Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein |
||||
| malF-malG-glgP1-malR2-malE | -46 | 5.6 | AAGAGCAAACGATTGCACAC | Csac_0427 |