Orthologous regulated operons containing malR2 gene

Properties
Regulog:	MalR2 - Thermoanaerobacterales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes

Built upon 17 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Anaerocellum thermophilum DSM 6725
Position: -45 Score: 5.84221 Sequence: AAGAGCAAACGATTGCACAT Locus tag: Athe_2578 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: Athe_2577 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: Athe_2576 Name: glgP1 Funciton: Glycogen phosphorylase (EC 2.4.1.1) Locus tag: Athe_2575 Name: malR2 Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family Locus tag: Athe_2574 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
malF-malG-glgP1-malR2-malE	-45	5.8	AAGAGCAAACGATTGCACAT	Athe_2578
Caldicellulosiruptor saccharolyticus DSM 8903
Position: -46 Score: 5.63904 Sequence: AAGAGCAAACGATTGCACAC Locus tag: Csac_0427 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: Csac_0428 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: Csac_0429 Name: glgP1 Funciton: Glycogen phosphorylase (EC 2.4.1.1) Locus tag: Csac_0430 Name: malR2 Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family Locus tag: Csac_0431 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
malF-malG-glgP1-malR2-malE	-46	5.6	AAGAGCAAACGATTGCACAC	Csac_0427

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --