Orthologous regulated operons containing malE gene
| Regulog: | MalR2 - Thermoanaerobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Anaerocellum thermophilum DSM 6725 | ||||
|
Position: -45
Score: 5.84221 Sequence: AAGAGCAAACGATTGCACAT
Locus tag: Athe_2578
Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: Athe_2577
Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: Athe_2576
Name: glgP1 Funciton: Glycogen phosphorylase (EC 2.4.1.1)
Locus tag: Athe_2575
Name: malR2 Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
Locus tag: Athe_2574
Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein |
||||
| malF-malG-glgP1-malR2-malE | -45 | 5.8 | AAGAGCAAACGATTGCACAT | Athe_2578 |
| Caldicellulosiruptor saccharolyticus DSM 8903 | ||||
|
Position: -46
Score: 5.63904 Sequence: AAGAGCAAACGATTGCACAC
Locus tag: Csac_0427
Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: Csac_0428
Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: Csac_0429
Name: glgP1 Funciton: Glycogen phosphorylase (EC 2.4.1.1)
Locus tag: Csac_0430
Name: malR2 Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR, LacI family
Locus tag: Csac_0431
Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein |
||||
| malF-malG-glgP1-malR2-malE | -46 | 5.6 | AAGAGCAAACGATTGCACAC | Csac_0427 |
| Thermoanaerobacter ethanolicus X514 | ||||
|
Position: -230
Score: 5.52034 Sequence: ATGAGCAAAAGCTTGCAGAA
Locus tag: Teth514_1180
Name: amyA Funciton: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133)
Locus tag: Teth514_1181
Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
Locus tag: Teth514_1182
Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: Teth514_1183
Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 |
||||
| amyA-malE-malF-malG | -230 | 5.5 | ATGAGCAAAAGCTTGCAGAA | Teth514_1180 |
| Thermoanaerobacter italicus Ab9 | ||||
|
Position: -228
Score: 5.52034 Sequence: ATGAGCAAAAGCTTGCAGAA
Position: -106
Score: 4.92662 Sequence: AAGCGCAAGCGATTGCAAGA
Locus tag: Thit_1644
Name: amyA Funciton: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133)
Locus tag: Thit_1643
Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
Locus tag: Thit_1642
Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: Thit_1641
Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 |
||||
| amyA-malE-malF-malG | -228 | 5.5 | ATGAGCAAAAGCTTGCAGAA | Thit_1644 |
| -106 | 4.9 | AAGCGCAAGCGATTGCAAGA | ||
| Thermoanaerobacter tengcongensis MB4 | ||||
|
Position: -229
Score: 4.98304 Sequence: ATGAGCAAAAGCTTGCAGAG
Position: -107
Score: 5.46392 Sequence: TAGCGCAAGCGATTGCAATA
Locus tag: TTE1832
Name: amyA Funciton: Cyclomaltodextrin glucanotransferase (EC 2.4.1.19); Maltogenic alpha-amylase (EC 3.2.1.133)
Locus tag: TTE1831
Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
Locus tag: TTE1830
Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: TTE1829
Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 |
||||
| amyA-malE-malF-malG | -229 | 5 | ATGAGCAAAAGCTTGCAGAG | TTE1832 |
| -107 | 5.5 | TAGCGCAAGCGATTGCAATA | ||