Orthologous regulated operons containing malI gene
| Regulog: | MalI - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio angustum S14 | ||||
|
Position: -245
Score: 6.00058 Sequence: GTGGTAAAACGTTTTATCAC
Position: -153
Score: 6.59652 Sequence: ATGATAAAACGTTTTATCAA
Position: -51
Score: 5.79811 Sequence: TAGATATAACGTTTTATATT
Locus tag: VAS14_19066
Name: malI Funciton: Maltose regulon regulatory protein MalI |
||||
| malI | -245 | 6 | GTGGTAAAACGTTTTATCAC | VAS14_19066 |
| -153 | 6.6 | ATGATAAAACGTTTTATCAA | ||
| -51 | 5.8 | TAGATATAACGTTTTATATT | ||
| Vibrio fischeri ES114 | ||||
|
Position: -140
Score: 6.14881 Sequence: ATGGTAAAACGTTTTACCAC
Position: -40
Score: 6.21316 Sequence: TAGGTGAAACGTTTTATCAA
Locus tag: VF_1720
Name: malI Funciton: Maltose regulon regulatory protein MalI |
||||
| malI | -140 | 6.1 | ATGGTAAAACGTTTTACCAC | VF_1720 |
| -40 | 6.2 | TAGGTGAAACGTTTTATCAA | ||
| Vibrio salmonicida LFI1238 | ||||
|
Position: -139
Score: 6.44179 Sequence: TTGGTAAAACGTTTTATCAA
Position: -40
Score: 6.65851 Sequence: TAGGTAAAACGTTTTATCTA
Locus tag: VSAL_I1618
Name: malI Funciton: Maltose regulon regulatory protein MalI |
||||
| malI | -139 | 6.4 | TTGGTAAAACGTTTTATCAA | VSAL_I1618 |
| -40 | 6.7 | TAGGTAAAACGTTTTATCTA | ||
| Vibrio shilonii AK1 | ||||
|
Position: -134
Score: 6.55534 Sequence: TTGATAAAACGTTTTATCAA
Position: -34
Score: 5.96474 Sequence: TTGATAAAACGTTTTTCCTA
Locus tag: VSAK1_23534
Name: malI Funciton: Maltose regulon regulatory protein MalI |
||||
| malI | -134 | 6.6 | TTGATAAAACGTTTTATCAA | VSAK1_23534 |
| -34 | 6 | TTGATAAAACGTTTTTCCTA | ||