Orthologous regulated operons containing celP gene
| Regulog: | BglR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Colwellia psychrerythraea 34H | ||||
|
Position: -108
Score: 6.59222 Sequence: ATTTGTAAGCGCTTACATTT
Locus tag: CPS_3697
Name: CPS_3697 Funciton: Predicted beta-glucoside transporter, GPH family
Locus tag: CPS_3696
Name: celP Funciton: Cellobiose phosphorylase
Locus tag: CPS_3695
Name: gntK Funciton: Gluconokinase (EC 2.7.1.12) |
||||
| CPS_3697-celP-gntK | -108 | 6.6 | ATTTGTAAGCGCTTACATTT | CPS_3697 |