Orthologous regulated operons containing Aflv_2187 gene

Properties
Regulog:	MalR2 - Bacillales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes

Built upon 24 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Anoxybacillus flavithermus WK1
Position: 91 Score: 6.19868 Sequence: TTGTGCAATCGTTTTCGCAA Locus tag: Aflv_2191 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: Aflv_2190 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: Aflv_2189 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: Aflv_2188 Name: nplT2 Funciton: Neopullulanase (EC 3.2.1.135) Locus tag: Aflv_2187 Name: null Funciton: Alpha-glucosidase (EC 3.2.1.20) Locus tag: Aflv_2186 Name: malR2 Funciton: Maltose utilization transcriptional regulator MalR2, LacI family
malE-malF-malG-nplT2-Aflv_2187-malR2	91	6.2	TTGTGCAATCGTTTTCGCAA	Aflv_2191

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --