Orthologous regulated operons containing manA3 gene
Regulog: | ManR - Streptomycetaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Mannosides utilization; Mannose utilization |
Effector: | Mannose |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Streptomyces avermitilis MA-4680 | ||||
Position: -210
Score: 5.10664 Sequence: CGGCGACAACGTTGTCTGAG
Position: -164
Score: 4.82656 Sequence: AACCGACAACGATGTCAAGC
Locus tag: SAV_2253
Name: manA3 Funciton: Alpha-1,2-mannosidase |
||||
manA3 | -210 | 5.1 | CGGCGACAACGTTGTCTGAG | SAV_2253 |
-164 | 4.8 | AACCGACAACGATGTCAAGC |