Orthologous regulated operons containing SCO6428 gene
| Regulog: | ManR - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Mannosides utilization; Mannose utilization |
| Effector: | Mannose |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces coelicolor A3(2) | ||||
|
Position: -41
Score: 6.35152 Sequence: GCTTGACAACGTTGTCCACC
Locus tag: SCO6428
Name: SCO6428 Funciton: putative secreted protein |
||||
| SCO6428 | -41 | 6.4 | GCTTGACAACGTTGTCCACC | SCO6428 |