Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing tal gene

Properties
Regulog: RbsR - Clostridia-1
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Clostridium butyricum 5521
Position: -120
Score: 4.5724
Sequence: TAATAGAAGCAGTTAAATTT
Locus tag: CBY_2443
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: CBY_2442
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: CBY_2441
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: CBY_2440
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: CBY_2439
Name: tal
Funciton: transaldolase
Locus tag: CBY_2438
Name: tkt
Funciton: transketolase
Locus tag: CBY_2437
Name: rbsR
Funciton: Ribose operon transcriptional regulator, LacI family
rbsD-rbsA-rbsC-rbsB-tal-tkt-rbsR -120 4.6 TAATAGAAGCAGTTAAATTT CBY_2443
© 2009-2020 RegPrecise